+44 (0) 1223 755950
+1 832 327 7413
Click on the image to see the image legend
Target | IL17RB |
Reactivity | Human |
Tested Applications | RNAi |
Host | E. coli |
Form | Lyophilized |
Quality Control | The sequence of shRNA is guaranteed by sequencing. |
Storage | Store lyophilized shRNA plasmid DNA at -20 °C with desiccant. Stable for one year. Once resuspended, store at 4 °C for short term storage or -80 °C for long term storage. Avoid repeated freeze/thaw cycles. |
UniProt Primary AC | Q9NRM6 (UniProt, ExPASy) |
Gene Symbol | IL17RB |
GeneID | 55540 |
NCBI Accession | NM_018725.3 |
KEGG | hsa:55540 |
Sequence | CCCTTCCATGTCTGTGAATTT |
Availability | Shipped within 15-20 working days. |
Note | This product is for research use only. |
Directions for use | Resuspend lyophilized shRNA plasmid DNA in 500 μl of deionised water. Each vial contains 50 μg of lyophilized shRNA plasmid DNA. Suitable for up to 50 transfections. |