Human IL17RB shRNA Plasmid

REQUEST MORE INFO
Catalogue No: abx991278
Price: US$377.00
(Size: 50 µg)

Click on the image to see the image legend

Available Options

* Size:

Add to Shopping Cart Buy It Now GET A QUOTE

Documents

Datasheet SDS
shRNA Plasmid to inhibit IL17RB expression by RNA interference. Each vial contains 50 μg of lyophilized shRNA.

Target IL17RB
Reactivity Human
Tested Applications RNAi
Host E. coli
Form Lyophilized
Quality Control The sequence of shRNA is guaranteed by sequencing.
Storage Store lyophilized shRNA plasmid DNA at -20 °C with desiccant. Stable for one year. Once resuspended, store at 4 °C for short term storage or -80 °C for long term storage. Avoid repeated freeze/thaw cycles.
UniProt Primary AC Q9NRM6 (UniProt, ExPASy)
Gene Symbol IL17RB
GeneID 55540
NCBI Accession NM_018725.3
KEGG hsa:55540
Sequence CCCTTCCATGTCTGTGAATTT
Availability Shipped within 15-20 working days.
Note This product is for research use only.
Directions for use Resuspend lyophilized shRNA plasmid DNA in 500 μl of deionised water. Each vial contains 50 μg of lyophilized shRNA plasmid DNA. Suitable for up to 50 transfections.
Research Articles on IL17RB


Write a review

Related Products